Non-negative Least Squares Approach to Quantification of 1H Nuclear Magnetic Resonance Spectra of Human Urine.

Because of its quantitative character and capability for high-throughput screening, 1H nuclear magnetic resonance (NMR) spectroscopy is used extensively in the profiling of biofluids such as urine and blood plasma. However, the narrow frequency bandwidth of 1H NMR spectroscopy leads to a severe overlap of the spectra of components present in the complex mixtures such as biofluids. Therefore, 1H NMR-based metabolomics analysis is focused on targeted studies related to concentrations of the small number of metabolites. Here, we propose a library-based approach to quantify proportions of overlapping metabolites from 1H NMR mixture spectra. The method boils down to the linear non-negative least squares (NNLS) problem, whereas proportions of the pure components contained in the library stand for the unknowns. The method is validated on an estimation of the proportions of (i) the 78 pure spectra, presumably related to type 2 diabetes mellitus (T2DM), from their synthetic linear mixture; (ii) metabolites present in 62 1H NMR spectra of urine of subjects with T2DM and 62 1H NMR spectra of urine of control subjects. In both cases, the in-house library of 210 pure component 1H NMR spectra represented the design matrix in the related NNLS problem. The proposed method pinpoints 63 metabolites that in a statistically significant way discriminate the T2DM group from the control group and 46 metabolites discriminating control from the T2DM group. For several T2DM-discriminative metabolites, we prove their presence by independent analytical determination or by pointing out the corresponding findings in the published literature.

Study of the diacylglycerol composition in the liver and serum of mice with prediabetes and diabetes using MeV TOF-SIMS.

AIMS: Hepatic insulin resistance, induced by fat, occurs before peripheral resistance and leads to prediabetes and diabetes. If insulin resistance is detected earlier, lifestyle changes could prevent or delay disease development. Therefore, we analysed lipids in the liver and serum of prediabetic and diabetic mice by MeV TOF-SIMS with a focus on diacylglycerols (DAGs) as the best predictor of (liver) resistance. METHODS: Glucose impairment was spontaneously developed or induced by HFD in NOD/LtJ mice, and prediabetic and diabetic mice were selected according to their glucose levels. MeV TOF-SIMS was applied to image the lipid distribution in the liver and to relatively quantify lipids related to insulin resistance in both the liver and serum. RESULTS: The same lipids were detected in the liver and serum but with different intensities between mice. The intensity of DAGs and fatty acids was higher in the diabetic than that in the prediabetic liver. Imaging of liver tissue showed a more compact density of prediabetic (non-fatty) than diabetic liver with DAG remodelling in diabetes. DAGs, which are greatly increased in diabetic serum, were successfully detected and quantified already in prediabetes. CONCLUSION: MeV TOF-SIMS applied to the serum presents an excellent tool for in vivo monitoring of disease development over time.

Library-assisted nonlinear blind separation and annotation of pure components from a single 1H nuclear magnetic resonance mixture spectra.

Due to its capability for high-throughput screening 1H nuclear magnetic resonance (NMR) spectroscopy is commonly used for metabolite research. The key problem in 1H NMR spectroscopy of multicomponent mixtures is overlapping of component signals and that is increasing with the number of components, their complexity and structural similarity. It makes metabolic profiling, that is carried out through matching acquired spectra with metabolites from the library, a hard problem. Here, we propose a method for nonlinear blind separation of highly correlated components spectra from a single 1H NMR mixture spectra. The method transforms a single nonlinear mixture into multiple high-dimensional reproducible kernel Hilbert Spaces (mRKHSs). Therein, highly correlated components are separated by sparseness constrained nonnegative matrix factorization in each induced RKHS. Afterwards, metabolites are identified through comparison of separated components with the library comprised of 160 pure components. Thereby, a significant number of them are expected to be related with diabetes type 2. Conceptually similar methodology for nonlinear blind separation of correlated components from two or more mixtures is presented in the Supplementary material. Single-mixture blind source separation is exemplified on: (i) annotation of five components spectra separated from one 1H NMR model mixture spectra; (ii) annotation of fifty five metabolites separated from one 1H NMR mixture spectra of urine of subjects with and without diabetes type 2. Arguably, it is for the first time a method for blind separation of a large number of components from a single nonlinear mixture has been proposed. Moreover, the proposed method pinpoints urinary creatine, glutamic acid and 5-hydroxyindoleacetic acid as the most prominent metabolites in samples from subjects with diabetes type 2, when compared to healthy controls.

Offset-sparsity decomposition for automated enhancement of color microscopic image of stained specimen in histopathology.

We propose an offset-sparsity decomposition method for the enhancement of a color microscopic image of a stained specimen. The method decomposes vectorized spectral images into offset terms and sparse terms. A sparse term represents an enhanced image, and an offset term represents a "shadow." The related optimization problem is solved by computational improvement of the accelerated proximal gradient method used initially to solve the related rank-sparsity decomposition problem. Removal of an image-adapted color offset yields an enhanced image with improved colorimetric differences among the histological structures. This is verified by a no-reference colorfulness measure estimated from 35 specimens of the human liver, 1 specimen of the mouse liver stained with hematoxylin and eosin, 6 specimens of the mouse liver stained with Sudan III, and 3 specimens of the human liver stained with the anti-CD34 monoclonal antibody. The colorimetric difference improves on average by 43.86% with a 99% confidence interval (CI) of [35.35%, 51.62%]. Furthermore, according to the mean opinion score, estimated on the basis of the evaluations of five pathologists, images enhanced by the proposed method exhibit an average quality improvement of 16.60% with a 99% CI of [10.46%, 22.73%].

Unsupervised segmentation of low-contrast multichannel images: discrimination of tissue components in microscopic images of unstained specimens.

Low-contrast images, such as color microscopic images of unstained histological specimens, are composed of objects with highly correlated spectral profiles. Such images are very hard to segment. Here, we present a method that nonlinearly maps low-contrast color image into an image with an increased number of non-physical channels and a decreased correlation between spectral profiles. The method is a proof-of-concept validated on the unsupervised segmentation of color images of unstained specimens, in which case the tissue components appear colorless when viewed under the light microscope. Specimens of human hepatocellular carcinoma, human liver with metastasis from colon and gastric cancer and mouse fatty liver were used for validation. The average correlation between the spectral profiles of the tissue components was greater than 0.9985, and the worst case correlation was greater than 0.9997. The proposed method can potentially be applied to the segmentation of low-contrast multichannel images with high spatial resolution that arise in other imaging modalities.

Role of subcolloidal (nanosized) precursor species in the early stage of the crystallization of zeolites in heterogeneous systems.

A critical analysis was carried out for the purpose of understanding the role of subcolloidal (nanosized) (alumino)silicate precursor species in the early stage of crystallization of zeolites in heterogeneous systems (hydrogels). The formation and evolution of these subcolloidal species in both the solid and the liquid phases were investigated by various experimental methods such a scanning electron microscopy (SEM, FE-SEM), transmission electron microscopy, atomic force microscopy, particle size analysis, pH measurement, atomic absorption spectroscopy, and dynamic light scattering, after careful separation of intermediates from reaction mixture by two-step centrifugation treatment. The results revealed that a chain of processes (i) the formation of low-molecular-weight (LMW) silicate species, by dissolution of Al-enriched amorphous silica, and their aggregation into about 3 nm sized primary precursor species (PPSs), (ii) the formation of larger (∼3 to ∼15 nm sized) silicate precursor species (LSPSs) by a rapid aggregation/coalescence of PPSs, (iii) the formation of "gel" (primary amorphous precursor) by a random aggregation of LSPSs at room temperature, and (iv) the formation of the worm-like particles (secondary amorphous precursor) occurred in the solid phase during heating of the reaction mixture (hydrogel) from room temperature to 170 °C. It is interesting that almost the same processes occur in the liquid phase but with decreased rate according to the relative low concentration of LMW silicate species. With the above described findings, it is highly expected that the manipulation of crystallization pathway through controlling the formation/evolution of precursor species in the initial stage of the process can be achieved.

Polymorphisms in the IL-18 and IL-12B genes and their association with the clinical outcome in Croatian patients with Type 1 diabetes.

Genetic variants of IL-18 and IL-12B may be important in immunoregulatory abnormalities, observed in the patients with Type 1 diabetes mellitus (T1DM), that contribute to individual differences in response to a treatment. Therefore, we examined the significance of IL-18-137G/C, IL-18-607C/A, and IL-12B A/C polymorphisms in Croatians (187 patients, 236 controls), not only as factors that contribute to susceptibility to T1DM, but also as determinants of the clinical presentation of disease. The polymorphism screening has been performed using PCR sequence-specific primers (IL-18) or PCR-RFLP (IL-12B) approach. Results were evaluated by GraphPad Prism and Sigma Stat 3.5, Arlequin software and calculator for Hardy-Weinberg equilibrium. The genotype, allele and haplotype distribution were not statistically different between the patients and control subjects. The clinical parameter analysis revealed that patients with minor alleles at each locus, IL-18-137C/-607A, were significantly younger at T1DM onset than carriers of major alleles, IL-18-137G/-607C (20 vs 23.5 years). Moreover, the concomitant presence of minor alleles not only of IL-18 but also of IL-12B, is associated with the risk of disease progression even at younger age. These patients developed diabetes at 16 years of age, what is significantly earlier (p=0.044) compared to 25.5 years of age in patients with common alleles IL-18-137G/-607C/IL-12B A. Furthermore, combined genotype analysis of IL-18 and IL-12B has pointed out that patients with CC/AA/AA genotype have the worst glucose control based on HbA1c (8.7%, range 6.8-13.1%). In conclusion, susceptibility to T1DM in Croatians is not strongly associated with IL-18-137/-607 and IL-12B polymorphisms. These SNPs are associated with the higher risk of earlier disease development and might be implicated in the effectiveness of glycemic control.

Rational variety mapping for contrast-enhanced nonlinear unsupervised segmentation of multispectral images of unstained specimen.

A methodology is proposed for nonlinear contrast-enhanced unsupervised segmentation of multispectral (color) microscopy images of principally unstained specimens. The methodology exploits spectral diversity and spatial sparseness to find anatomical differences between materials (cells, nuclei, and background) present in the image. It consists of rth-order rational variety mapping (RVM) followed by matrix/tensor factorization. Sparseness constraint implies duality between nonlinear unsupervised segmentation and multiclass pattern assignment problems. Classes not linearly separable in the original input space become separable with high probability in the higher-dimensional mapped space. Hence, RVM mapping has two advantages: it takes implicitly into account nonlinearities present in the image (ie, they are not required to be known) and it increases spectral diversity (ie, contrast) between materials, due to increased dimensionality of the mapped space. This is expected to improve performance of systems for automated classification and analysis of microscopic histopathological images. The methodology was validated using RVM of the second and third orders of the experimental multispectral microscopy images of unstained sciatic nerve fibers (nervus ischiadicus) and of unstained white pulp in the spleen tissue, compared with a manually defined ground truth labeled by two trained pathophysiologists. The methodology can also be useful for additional contrast enhancement of images of stained specimens.

Genetic evaluation of the TNF-α -238G>A and -308G>A promoter polymorphisms in Croatian patients with type I diabetes.

A case-control study was performed to establish a potential association of two TNF-α gene promoter SNPs (-238G>A and -308G>A) with occurrence of type 1 Diabetes mellitus (T1DM) in Croatian population (174 patients and 193 healthy controls). Genotypes (obtained by polymerase chain reaction-restriction fragment length polymorphism), and the clinical parameters of T1DM patients were statistically evaluated by SPSS 13 and Arlequin software, G*Power 3.0.10 program, and calculator for Hardy-Weinberg equilibrium. The frequency of the risk (A) allele, as well as the distribution of high-expression (GA, AA) genotypes were significantly higher (p < 0.0001) in T1DM patients only at locus -308. The distribution of the -238G/-308A haplotype was also significantly higher in patients compared with controls (27.6% vs 9.6%, p < 0.0001). Gender-dependent analysis revealed that female T1DM -308GA genotype carriers exhibit considerably stronger association with T1DM (odds ratio = 6.37, 95% confidence interval = 3.16-12.85) than male -308GA patients (odds ratio = 2.71, 95% confidence interval = 1.31-5.59). Clinical parameter analysis of T1DM patients revealed significantly decreased level of hemoglobin A(1)c (HbA(1)c) in -238A allele carriers compared with -238G allele carriers (6.55% vs 7.17%, p = 0.022), as well as the tendency of the risk allele carriers at -238 or -308 locus to develop T1DM earlier in life compared with non-risk allele carriers. In conclusion, susceptibility to T1DM in the Croatian population is strongly associated with the TNF-α -308G>A polymorphism, especially in women. In addition, significantly lower HbA(1c) levels found in T1DM -238A allele carriers might indicate better glycemic control in these patients.

Association of PTPN22 C1858T and CTLA-4 A49G polymorphisms with Type 1 Diabetes in Croatians.

In this case-control study the association between the PTPN22 1858T and CTLA-4 49G gene variants and T1D in Croatian population was examined. We found that distribution of PTPN22 C1858T and CTLA-4 A49G genotypes between T1D patient (n=102) and control (n=193) groups differ significantly (p<0.0001 and p=0.012, respectively). Moreover, although the risk alleles of both SNPs are distributed more frequently in patients, the significant difference is observed only for PTPN22 1858T allele (p<0.0001). This is therefore the first evidence that analyzed gene variants contribute to T1D pathogenesis in Croatian population.

Skin decontamination with mineral cationic carrier against sarin determined in vivo.

Our Institute's nuclear, biological, and chemical defense research team continuously investigates and develops preparations for skin decontamination against nerve agents. In this in vivo study, we evaluated skin decontamination efficacy against sarin by a synthetic preparation called Mineral Cationic Carrier (MCC) with known ion exchange, absorption efficacy and bioactive potential. Mice were treated with increasing doses of sarin applied on their skin, and MCC was administered immediately after contamination. The results showed that decontamination with MCC could achieve therapeutic efficacy corresponding to 3 x LD(50) of percutaneous sarin and call for further research.

Efficacy of mineral cationic carrier against sulphur mustard in skin decontamination.

The aim of this study was to evaluate decontamination (absorption) efficacy of a preparation called Mineral Cationic Carrier (MCC) against skin contamination with sulphur mustard in vivo. MCC is a synthetic preparation with known ion exchange, absorption efficiency, and bioactive potential. CBA mice were applied increasing doses of sulphur mustard on their skin and MCC was administered immediately after skin contamination. The results have confirmed the decontamination efficacy of MCC preparation, corresponding to 8.4 times the LD50 of percutaneous sulphur mustard, and call for further investigation.

Toxicological assessment of P-9801091 plant mixture extract after chronic administration in CBA/HZg mice--a biochemical and histological study.

Acute, subchronic and chronic effects of the P-9801091 plant mixture extract at a dose of 20 mg/kg body mass were assessed in serum of healthy CBA/HZg mice at 24 hours, 7 days, 3 months and 6 months of treatment (experimental group), and compared with the values obtained in the control group of untreated healthy CBA/HZg mice. The P-9801091 plant mixture extract is an antihyperglycemic preparation containing Myrtilli folium (Vaccinium myrtillus L.), Taraxaci radix (Taraxacum officinale Web.), Cichorii radix (Cichorium intybus L.), Juniperi fructus (Juniperus communis L.), Centaurii herba (Centaurium umbellatum Gilib.), Phaseoli fructus sine semine (Phaseolus vulgaris L.), Millefolii herba (Achillea millefolium L.), Mori folium (Morus nigra L.), Valerianae radix (Valeriana officinalis L.) and Urticae herba et radix (Urtica dioica L). Toxic effect of the P-9801091 plant mixture extract was assessed by the following biochemical parameters: urea, creatinine, aspartate aminotransferase (AST), alanine aminotransferase (ALT) and cholesterol. Also, histopathological examination of the kidneys, liver, spleen, pancreas, testes and lungs was performed. Results of biochemical testing performed at specified time points generally showed no statistically significant differences from control values, with the only exception of the catalytic concentration of AST in the experimental group measured on day 7, which was significantly increased as compared with the control group (p<0.05). Pathohistological examination including characteristic organ and tissue structure, and parenchyma relationship to the adjacent blood vessels and connective tissue in the examined organs revealed no major pathologic changes.

K-ras and Dpc4 mutations in chronic pancreatitis: case series.

AIM: To assess whether alterations in the K-ras, p53, and DPC4 genes are present in pancreatitis, a potential precancerous condition that can progress to pancreatic adenocarcinoma. To investigate the alterations occurring at hot spots of K-ras (exon 1), p53 (exons 5 and 7), and DPC4 (exons 8, 10 and 11). METHODS: In 10 patients with acute and 22 with chronic pancreatitis, without pancreatic intraepithelial neoplasia (PanIN), DNA was isolated from paraffin embedded tissue samples. The extracted DNA was analyzed by polymerase chain reaction (PCR), restriction fragment length polymorphism (RFLP) analysis, single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. RESULTS: In acute pancreatitis samples no mutations were found in any of the investigated genes. In 7 out of 22 samples of chronic pancreatitis nucleotide substitution at exon 1 of K-ras (five at codon 12 and two at codon 13) were found. No mutations in p53 (exons 5 and 7) were detected. Two samples had nucleotide substitutions at exons 8 and 11 of DPC4, introducing STOP signal and change in the amino acid sequence, respectively. One chronic pancreatitis sample displayed simultaneous mutations in K-ras (exon 1, codon 12) and DPC4 (exon 8, codon 358). CONCLUSION: Mutations of K-ras and Dpc4 genes can accumulate already in non-malignant, inflammatory pancreatic tissue, suggesting its applicability in monitoring of further destruction of pancreatic tissue and progression into malignancy.

Effect of acarbose on alanine aminotransferase and aspartate aminotransferase activities in the liver of control and diabetic CBA mice.

The purpose of this study was to examine the short-term effects of diet containing 0.1% (m/m) of acarbose in standard laboratory chow on specific liver enzyme activities: alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in control and diabetic CBA mice. Diabetes was induced by intravenous injection of alloxan monohydrate in a dose of 75 mg kg(-1) mouse body mass seven days before the treatment with acarbose. There were four groups of CBA mice in the experiment: control (C) mice (n = 6) and diabetic (D) mice (n = 8) fed standard chow; control (C/A-100) mice (n = 8) and diabetic (D/A-100) mice (n = 8) fed standard chow containing 0.1% acarbose. Diabetes induced a decrease of the ALT catalytic activities to 69.6% of the control value. A similar level of decreased ALT catalytic activity was detected in the liver of control and diabetic mice fed chow containing 0.1% acarbose. No changes in the specific and total activities of AST in the liver of experimental groups were observed.

Infrequent alteration of the DPC4 tumor suppressor gene in renal cell carcinoma.

The aim of this study was to investigate the alterations in the DPC4 tumor suppressor gene in renal cell carcinoma (RCC). The study included 32 tumor specimens from Croatian patients with a diagnosis of RCC. Loss of heterozygosity (LOH) was investigated using three specific oligonucleotide primers for the three DPC4 polymorphic markers. Our investigation of mutations in the DPC4 gene was focused on exons 2, 8, 10 and 11. These exons belong to the mad homology domains 1 (exon 2) and 2 (exons 8-11). The presence of previously documented mutation in exons 2 (codon 100), 8 (codon 358), 10 (codon 412), and 11 (codon 493) was investigated by restriction fragment length polymorphism (RFLP) analysis, as a first screening method. Finally, the study was extended to search for any other type of mutation in the four selected exons by single strand conformation polymorphism (SSCP) assay. To increase heterozygosity, all 32 tumor specimens were tested with primers for three polymorphic markers. A total of 30 (94%) were heterozygous (informative). LOH at any of these markers was only revealed in four (13%) of the 30 informative samples. No tumor samples were positive for mutation in the four investigated exons analyzed by RFLP. In addition, no samples showed other types of mutation in denaturing conditions. Genetic alterations were shown only in a minority of patients, probably because mutation analysis of the DPC4 gene has only been partially covered by our work. It seems that exon 2 (belonging to the MH1 domain) and exons 8, 10, 11 (belonging to the MH2 domain) are not altered in RCC. This investigation must be extended on other exons of DPC4 for a better understanding a role of this gene in renal cell carcinoma.

Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of Croatian patients: identification of a novel somatic mutation.

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers.

Differing effects of two iron compounds on experimental arthritis, TNF-alpha levels and immune response in mice.

The effects of ferric-sorbitol-citrate and ferric-citrate on the severity of experimental arthritis, TNF-alpha secretion and the immune status were examined in mice. Arthritis was induced by footpad injection of methylated BSA and intraperitoneal injection of Bordetella pertussis. Joint and footpad swelling were measured weekly by a caliper. TNF-alpha serum levels were measured by ELISA. The immune status was determined by the response of mouse lymphocytes to ConA in vitro and by the antigen-presenting cell assay. Experimental arthritis was aggravated by ferric-citrate, whereas ferric-sorbitol-citrate did not promote it. If applied to normal (non-arthritic) mice three times a week for 4 weeks, ferric-sorbitol-citrate stimulated isolated splenocytes to increase production of TNF-alpha, the function of antigen-presenting cells and lymphocyte proliferation in response to ConA in vitro. TNF-alpha production by cultured splenocytes was also stimulated. In mice with antigen-induced arthritis, iron compounds did not additionally stimulate TNF-alpha production. Thus, we have shown that ferric-sorbitol-citrate stimulated TNF-alpha production, antigen-presenting cell activity and cellular immune response. Development of antigen-induced arthritis and TNF-alpha production in arthritic mice were not stimulated.

Amylin-induced cytotoxicity is associated with activation of caspase-3 and MAP kinases.

Nanomolar concentrations of human amylin promote death of RINm5F cells in a time- and concentrationdependent manner. Morphological changes of chromatin integrity suggest that cells are predominantly undergoing apoptosis. Human amylin induces significant activation of caspase-3 and strong and sustained phosphorylation of stress-activated protein kinases, c-Jun N-terminal kinase (JNK) and p38, that precedes cell death. Extracellular signal-regulated kinase (ERK) activation was not concomitant with JNK and/or p38 activation. Activation of caspase-3 and mitogen-activated protein kinases (MAPKs) was detected by Western blot analysis. Addition of the MEK1 inhibitor PD 98059 had no effect on amylin-induced apoptosis, suggesting that ERK activation does not play a role in this apoptotic scenario. A correlative inhibition of JNK activation by the immunosuppressive drug FK506, as well as a selective inhibition of p38 MAPK activation by SB 203580, significantly suppressed procaspase-3 processing and the extent of amylin-induced cell death. Moreover, simultaneous pretreatment with both FK506 and SB 203580, or with the caspase-3 inhibitor Ac-DEVD-CHO alone, almost completely abolished procaspase-3 processing and cell death. Thus, our results suggest that amylin-induced apoptosis proceeds through sustained activation of JNK and p38 MAPK followed by caspase-3 activation.